Purifying and Indexing Technology for Nucleic Acids-Based Next Generation Storage Medium by Hansol Choi

Author:Hansol Choi
Language: eng
Format: epub
ISBN: 9789811942747
Publisher: Springer Nature Singapore

Table 3.1Universal primer and adapter primer sequences were used for the experiments

Forward elongation primer

5’ACACTCTTTCCCTACACGACGCTCTTCCGATCT3’

Reverse amine primer

5’GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT3’

P5 adaptor primer

5’AATGATACGGCGAACCACCGAGATCTACA [i5 index] ACACTCTTTCCCTACACGAC3’

P7 adaptor primer

5’CAAGCAGAAGACGGCATACGAGAT [i7 index] GTGACTGGAGTTCAGACGTGTGCTC3’

The chemical synthesis of oligo utilizes phosphoramidite chemistry, and coupling efficiency is not 100%. During the synthesis, phosphoramidite is not coupled to some populations, or more than one phosphoramidite can be coupled at a cycle if the terminator is accidentally missing. Therefore, oligo synthesis is prone to length altering errors including deletions and insertions. In addition, the ratio of oligos with errors significantly increases as the lengths and complexity of the oligos increase. To meet the demand for highly complex oligo libraries, I developed MOPSS that can increase the fidelity of the oligo libraries. MOPSS does not require any additional design restrictions. MOPSS is initiated by universal primer hybridization and nucleotide coupling is repeated until it reaches the region for the biotin-dATPs binding located at another universal primer region near the solid support [2]. In addition to biotin-dATPs, other types of biotin-modified nucleotides can be used for the final coupling steps by adjusting the design and repetitive coupling cycles. Purification efficiency might be further optimized in the future since the coupling efficiency of each nucleotide differs. After the coupling cycles with the reversible terminator, the biotin-dATP binding region will be passed if the molecules are truncated, or additional cycles will be required if there is an insertion error despite the number of coupled nucleotides being the same. Considering the case of using biotin-dATPs as the final coupling nucleotide, biotin-dATPs might be coupled to oligos with indels if there exist other thymine bases in the template strand. Still, MOPSS is a valuable technology if we could design a universal primer region not to have any thymine base closer than a few base pairs from the biotin-dATP binding region because the most common type error is single base indels which can be eliminated with MOPSS.

Download

Copyright Disclaimer:
This site does not store any files on its server. We only index and link to content provided by other sites. Please contact the content providers to delete copyright contents if any and email us, we'll remove relevant links or contents immediately.